The non-inferiority margin was set at −10%. The MITT population included all subjects who received any amount of study drug according to their randomized

treatment group. The CE population included subjects in the MITT population who demonstrated sufficient A-769662 datasheet adherence to the protocol. Baseline characteristics and demographics were comparable between the two study arms in each study. The majority of participants were Caucasian males with a median age of 48 years diagnosed with cellulitis, major abscesses and infected wounds/ulcers. Of the 76% of subjects with a pathogen isolated, S. aureus was the most common; the proportion with MRSA was 40% in the ceftaroline group and 34% in the vancomycin plus aztreonam group. Aztreonam or a saline placebo was discontinued

if a Gram-negative pathogen was not identified. A priori-defined integrated analysis of the SAHA HDAC order primary endpoints demonstrated non-inferiority of ceftaroline in the MITT and CE populations (Table 3). In a planned secondary analysis of participants CYC202 in the CE population with at least one pathogen isolated, clinical cure was achieved in 92.7% of the subjects in the ceftaroline treatment group compared with 94.4% receiving combination therapy (difference −1.7, 95% CI −4.9% to 1.6%) at TOC [47]. In bacteremic subjects, cure rates were 84.6% (22 of 26 subjects) in Selleck Ixazomib the ceftaroline group compared to 100% (21 of 21 subjects) in the combination group (difference −15.4%, 95% CI −33.8% to 1.5%) [47]. In particular, cure rates among subjects with S. aureus bacteremia were lower in the ceftaroline group (88.9%), but not statistically different from the combination group (100%) with, notably, twice as many subjects having S. aureus bacteremia in the ceftaroline group than in the combination group (18 vs. 9, respectively). At late follow-up (21–35 days after completion of therapy), clinical

relapse rates were similar in the CE population: 1.1% and 0.9% in the ceftaroline and combination groups, respectively [47]. Post hoc analysis requested by the FDA to evaluate clinical response with cessation of lesion spread and apyrexia on day 3 of study therapy was conducted in a subgroup of 797 subjects and showed a weighted difference of 7.7% (95% CI 1.3–14.0%) in favor of ceftaroline [49]. Safety The safety profile of ceftaroline fosamil was evaluated in 1,740 participants and no unexpected safety concerns were identified [5, 48, 50, 51]. In the integrated FOCUS analysis, the most common adverse events occurring in greater than 2% of subjects receiving ceftaroline fosamil were diarrhea (4.2%), headache (3.4%), insomnia (3.1%) and phlebitis (2.8%) [50].

Participants completed a warm-up consisting of a five-minute cycle at a workload of 50 W. Following warm-up, participants pedaled at 110% of the maximum workload achieved during their VO2PEAK test. Keeping a cadence of BKM120 concentration 70 RPM, they pedaled until volitional exhaustion. Time was recorded in seconds, and total work done (TWD) was reported in kilojoules, determined by multiplying the workload in watts and the time

to selleck products exhaustion in seconds. Reliability of VO2PEAK, VT and TWD was determined using a subsample of subjects (n = 10) measured during each scheduled testing week. The test-retest intraclass correlation coefficient (R) was 0.96 (SE ± 0.1 L), 0.67 (SE ± 0.3 L), and 0.79 (SE ± 4.8 kJ), respectively, for the three measurement variables. A total of three testing sessions occurred throughout a nine-week period–familiarization (week 1), baseline (week 4), and post (week 9). Familiarization testing was implemented to reduce any learning effect–possibly influencing the dependent variables as well as the training intensity–from the initial VO2PEAK testing. Supplementation Following familiarization testing, participants were randomly assigned, in a double-blind fashion to either a Cr (n = 16) or a Pl (n = 17) group. A control group (CON;

n = 10), neither supplemented nor completed the high-intensity interval training, and instead only completed the testing measurements during each of the scheduled testing weeks. Participants I-BET151 cell line supplemented for a total of 30 days (10 days of familiarization period followed by an additional Cediranib (AZD2171) 20 days of supplementing and training) at a dose of 10 g per day, taken in two doses–one dose 30 minutes prior to and one dose immediately following training. Participants only supplemented on training days (5 days/week) under the supervision of the researchers, to monitor compliance. Participants in the Cr group consumed 5 g of creatine citrate mixed with 15 g dextrose per packet (Creatine Edge, FSI Nutrition, Omaha, NE), dissolved in 4-8 ounces of water. Similarly, participants in the PL group consumed 20 g of dextrose per packet dissolved

in 4-8 ounces of water. Both drinks were identical in appearance and taste. High-intensity interval training (HIIT) Training began at least 24-48 hours following the TTE test. Participants were required to visit the lab five days per week, for six weeks, to perform the HIIT. A two-week familiarization training period was implemented before taking baseline testing measurements. Due to the effectiveness of the training, and to the generally untrained population, a familiarization period was implemented to allow for all participants to quickly adapt to the high-intensity protocol. Previous research has shown significant improvements in performance with just two weeks of HIIT [21]. Furthermore, in a previous study from our lab in which a familiarization period was not used, the large adaptations from training may have masked any effects from supplementation [22].

To determine whether bacterial growth influenced the promoter activity, fluorescence measurements at several optical densities were performed (Figure 1B). Our data indicated that the promoter activities of both acrAB and acrD were constant throughout the growth phases in LB broth. Furthermore, the activity of the acrD promoter was 4 to 5-fold lower than the activity of the acrAB promoter throughout growth. Effect of substrate exposure on acrD selleckchem expression The expression of genes encoding multidrug efflux systems can be influenced by substrates, which interact with regulatory proteins and therefore increase gene transcription [32]. Above

results prompted us to investigate whether antimicrobials affect the expression of the acrD gene in E. amylovora. Therefore, we check details utilized a transcriptional JQEZ5 in vivo fusion between the promoter region of acrD and egfp (pBBR.acrD-Pro.egfp). In order to determine the promoter activity of acrD, we developed a screening

assay in a 96-well-plate format. Antimicrobial compounds were added to the plasmid-harboring cells by the 2-fold dilution method and EGFP fluorescence was determined after 24 hours. Only fluorescence values from substrate concentrations that did not inhibit bacterial growth were plotted versus optical density on a scatter plot (see Additional file 5). Outliers, showing higher fluorescence than the remaining dataset, thus potential inducers of acrD expression, were identified as deoxycholate, naringenin, tetracycline and zinc sulfate. In the next step, the effect on the activity of the acrD promoter was evaluated in batch cultures. We included novobiocin and fusidic acid since they were identified as substrates of AcrD Dichloromethane dehalogenase in E. coli[14, 33]. Additionally, we tested tannin because it displayed a 2-fold induction of acrD in qRT-PCR analysis (data not shown). After 24 hours incubation, the fluorescence signal was measured and normalized to an OD600 of 0.1 (Figure 2). The tested substrates were able

to induce the acrD promoter by approximately 2 to 3-fold. Among the tested substrates, deoxycholate and zinc, showed significant differences in comparison to the control (P < 0.05). Figure 2 Promoter activity of acrD from Erwinia amylovora determined by transcriptional fusions with the reporter egfp . Fluorescence was determined 24 h after incubation of the bacteria with various transporter substrates. Substrates were added to a final concentration of 1:10 of the determined MIC values; deoxycholate (50 μg/ml), zinc sulfate (15.6 μg/ml), tetracycline (0.16 μg/ml), naringenin (31.2 μg/ml), novobiocin (1.2 μg/ml), fusidic acid (0.31 μg/ml) and tannin (500 μg/ml). The dotted line indicates the basal acrD promoter activity. Statistically significant differences (P < 0.

Toxicity profiles were reported according to the WHO’s criteria. QOL was reported in different criteria, which based on different QOL scale. Remission

Rate of Pain 2491 patients from 30 cohort studies, 1216 in the transdermal fentanyl group and 1275 in the sustained-release oral morphine group were included in the meta-analysis of clinical efficacy. Overall effect of Stattic supplier remission rate of pain was analyzed by a fixed-effect model (fixed), because test for heterogeneity among the trials was not significant (p = 1.00). The remission rate in transdermal fentanyl group and sustained-release oral morphine group were 86.60% and 88.31% respectively, there was no significant difference [RR = 1.13, 95% CI (0.92, 1.38), P = 0.23]. More details were shown in Table 1 and the forest plot was shown in additional file Vactosertib mw 2. Table 1 Comparisons between Transdermal Fentanyl and Sustained-release www.selleckchem.com/products/MDV3100.html Oral Morphine Endpoints No. of patients/studies RR (95% CI)a Pb Ph c Remission rate 2491/30 1.13 (0.92, 1.38) 0.23 1.00 Constipation 2593/31 0.35 (0.27, 0.45) < 0.00001 < 0.00001 Nausea/vomiting 2593/31 0.57 (0.49, 0.67) < 0.00001 0.009 Vertigo/somnolence 2300/28 0.59 (0.51, 0.68) < 0.00001 0.08 a RR, relative risk; 95% CI, 95% confidence interval

b p value of significance tests of RR = 1 c p value of heterogeneity tests Adverse Effects Data on main adverse effects was summarized in the additional file 1. Overall effect of constipation and nausea/vomiting were analyzed by a random-effect model (random), because test for heterogeneity among the trials

was significant (p < 0.05). Compared with sustained-release oral morphine, pooled RR of constipation was 0.35 [95%CI (0.27, 0.45), p < 0.00001]; pooled RR of nausea/vomiting was 0.57 [95%CI (0.49, 0.67), p < 0.00001]. Overall effect of vertigo/somnolence was analyzed by a fixed-effect model (fixed), because test for heterogeneity among the trials was not significant (p = 0.08). Pooled RR of vertigo/somnolence was 0.59 [95%CI (0.51, 0.68), p < 0.00001] in patients used transdermal fentanyl. In short, transdermal fentanyl caused less adverse effects in comparison of sustained-release oral morphine in patients with moderate-severe cancer pain. More details were showed in Table 1 and the forest plots were shown in additional file 2. Quality of Life Six of selected trials were included to systematic selleck chemicals llc review of QOL [9, 14, 17, 32–34]. Primary endpoints of QOL were appetite, sleep, activity of daily living, mental states, emotion, communication and interest. QOL was not pooled for meta-analysis because different QOL evaluation criteria were used. After review of these six trials, all the data from each trial supported either transdermal fentanyl or sustained-release oral morphine improved QOL of cancer patients. In trial of Pang et al., more patients got better QOL after sustained-release oral morphine transferred to transdermal fentanyl [34].

While benefiting local economies, privatization also prompted concerns about biodiversity loss, as small landholders tend to cut down forests for immediate profit from timber and replace native forests with exotic trees of higher economic value that harbor little native diversity (Xu 2011). For example, Guangxi Province boasted 60 % forest coverage in 2011 (Guangxi Forestry Bureau Official Website: http://​www.​gxly.​cn:​8888/​pub/​cms/​1/​3537/​3544/​86963.​html),

but a third of this area was planted with non-native trees (Guangxi Forestry Bureau selleck Official Website: http://​www.​gxly.​cn:​8888/​pub/​cms/​1/​3545/​3559/​3566/​88981.​html). In fact, Guangxi grows the majority of the Eucalyptus in China, partially the outcome of forest tenure reform (Guangxi Forestry Bureau Official Website: http://​www.​gxly.​cn:​8888/​pub/​cms/​1/​3537/​3544/​69239.​html). Restoration-friendly orchid cultivation on privately held lands will provide owners

with much greater economic incentives than GDC941 other non-native forest products would, as indicated by the higher benefit-cost ratio of the restoration-friendly cultivation of D. catenatum (Table 1; Supplemental Table 1). Therefore, private orchid cultivation can be incorporated as part of a biodiversity-friendly management framework while forest tenure reform continues. This will promote conservation of the remaining natural habitats by offering a viable, profitable alternative to natural forest conversion (Table 1). Table 1 Comparison of initial investment, net present value, and benefit–cost ratio of restoration-friendly woodland cultivation, shade house cultivation of Dendrobium catenatum (tian-pi-shi-hu), and Eucalyptus plantation Crop Initial investmenta (¥/mu) Net present valueb (at the end of 6 years) (¥/mu) Benefit–cost ratioc Woodland cultivation of Dendrobium catenatum 22,000 621,461 28.25 Shadehouse cultivation of Dendrobium catenatum 210,560 4,703,050 23.33 Eucalyptus sp. plantation 370 839 3.268 Branched chain aminotransferase All monetary values are in Chinese Yuan RMB (¥) per mu. Calculations were based on crop rotation

of 6-year and market prices of 2012 in Guangdong Province, China. ¥1 = US$0.1628; 1 mu = 0.0667 ha aSee supplemental Table 1 for more details on yearly economic costs and CHIR-99021 mw benefits bNet present value is difference between the sum of discounted annual net benefits (for 6 years) and the initial investment cBenefit–cost ratio is the ratio of the sum of discounted annual net benefits (for 6 years) to the initial investment Incentives to preserve natural forests are especially needed in orchid-rich southwestern China, which is dominated by karst landscapes. Karst mountain ecosystems are inherently fragile because slopes are often steep, soils are scarce and of low fertility, and surface water can be scarce due to porous substrates (Jiang et al. 2008).

J Pharm Sci 2004, 93:1980–1992. 10.1002/jps.20098CrossRef 5. Ganta S, Devalapally H, Shahiwala A, Amiji M: A review of stimuli-responsive EPZ015666 ic50 nanocarriers for drug and gene delivery. J Control Release 2008, 126:187–204. 10.1016/j.jconrel.2007.12.017CrossRef 6. Takara K, Hatakeyama H, Kibria G, Ohga N, Hida K, Harashima H: Size-controlled, dual-ligand modified liposomes that target the tumor vasculature show promise for use in drug-resistant cancer therapy. J Control Release 2012, 162:225–232. 10.1016/j.jconrel.2012.06.019CrossRef

7. Tan S, Li X, Guo Y, Zhang Z: Lipid-enveloped hybrid nanoparticles for drug delivery. Nanoscale 2013, 5:860–872. 10.1039/c2nr32880aCrossRef 8. Mandal B, Bhattacharjee H, Mittal N, Sah H, Balabathula P, Thoma LA, Wood GC: Core-shell-type find more lipid-polymer hybrid nanoparticles as a drug delivery platform. Nanomedicine 2013,

9:474–491. 10.1016/j.nano.2012.11.010CrossRef 9. Sengupta S, Eavarone D, Capila I, Zhao G, Watson N, Kiziltepe T, Sasisekharan R: Temporal targeting of tumour cells and neovasculature with a nanoscale delivery system. Nature 2005, 436:568–572. 10.1038/nature03794CrossRef 10. Moon JJ, Suh H, Polhemus ME, Ockenhouse CF, Yadava A, Irvine DJ: Antigen-displaying lipid-enveloped PLGA nanoparticles as delivery agents for a Plasmodium vivax malaria vaccine. PLoS One 2012, 7:e31472. 10.1371/journal.pone.0031472CrossRef 11. Krishnamachari Y, Geary SM, Lemke CD, Salem AK: Nanoparticle delivery systems in cancer vaccines. Pharm Res 2011, 28:215–236. 10.1007/s11095-010-0241-4CrossRef Ferrostatin-1 in vitro 12. Salmaso S, Caliceti P: Stealth properties to improve therapeutic efficacy of drug nanocarriers. J Drug Deliv 2013, 2013:374252.CrossRef 13. Yang YY, Chia HH, Chung TS: Rucaparib in vivo Effect of preparation temperature on the characteristics and release profiles of PLGA microspheres containing protein fabricated by double-emulsion solvent extraction/evaporation method. J Control Release 2000, 69:81–96. 10.1016/S0168-3659(00)00291-1CrossRef

14. Brown RE, Jarvis KL, Hyland KJ: Protein measurement using bicinchoninic acid: elimination of interfering substances. Anal Biochem 1989, 180:136–139. 10.1016/0003-2697(89)90101-2CrossRef 15. Zhang L, Chan JM, Gu FX, Rhee JW, Wang AZ, Radovic-Moreno AF, Alexis F, Langer R, Farokhzad OC: Self-assembled lipid–polymer hybrid nanoparticles: a robust drug delivery platform. ACS Nano 2008, 2:1696–1702. 10.1021/nn800275rCrossRef 16. Foged C, Brodin B, Frokjaer S, Sundblad A: Particle size and surface charge affect particle uptake by human dendritic cells in an in vitro model. Int J Pharm 2005, 298:315–322. 10.1016/j.ijpharm.2005.03.035CrossRef 17. Takahashi T, Yamada Y, Kataoka K, Nagasaki Y: Preparation of a novel PEG-clay hybrid as a DDS material: dispersion stability and sustained release profiles. J Control Release 2005, 107:408–416. 10.1016/j.jconrel.2005.03.031CrossRef 18.

Tropical storm surges and waves can overwhelm island communities, as occurred at Manihiki (Fig. 5a), northern Cook Islands, during passage of Cyclone Martin in November 1997—only four houses were left standing in the two island villages and 20 residents were lost (de Scally 2008).

Maragos et al. (1973) provide a graphic description of flooding and wave overtopping on Funafuti Atoll, Tuvalu, during Cyclone Bebe in October 1972. Forbes (1996) and Solomon and Forbes (1999) described storm impacts from Cyclone Ofa in 1990 on the raised island of Niue (Fig. 7). Numerous facilities on top of coastal Selleckchem JNK-IN-8 cliffs up to 25 m high were damaged severely by storm waves breaking against the cliffs. Many of these facilities were repaired, only to be damaged even more severely by category 5 Cyclone Heta 14 years later. Thus, while raised atolls are largely immune to storm flooding, their eFT508 manufacturer narrow reef fringe, allowing deep-water waves to break almost directly against the cliffs, exposes cliff-top infrastructure and properties to extraordinary wave impact. Sea-level rise and variability Atolls and the low-lying terraces of high islands are susceptible to more frequent or higher flooding under climate-induced acceleration CH5424802 in vivo of global mean SLR. Deepening of water over reefs may increase wave energy at the shoreline and salt water may intrude into island soils and aquifers.

Sea-level variability due to ENSO or other large-scale circulation, as well as tides and storm surges, all ride on the MSL. Thus it is important

to develop robust projections of local SLR for individual regions and islands. These require knowledge of the global drivers as well as local factors such as uplift or subsidence rates. There is a growing consensus that the SLR projections of the IPCC (2007) AR4 were conservative and that SLR this century is likely to exceed AR4 estimates (Rahmstorf et al. 2007; Rahmstorf 2010; Church and White 2011). Post-AR4 projections of twenty-first century global mean SLR range up to 1.4 m or more but less than 2 m (Rahmstorf 2007, 2010; Pfeffer et al. 2008; Grinsted et Cytidine deaminase al. 2009; Jevrejeva et al. 2010, 2012; Rahmstorf et al. 2012b). Church et al. (2004, 2008), Church and White (2006, 2011), Domingues et al. (2008), Jevrejeva et al. (2008), Cazenave and Llovel (2010) and others have documented the slow rise of GMSL since the nineteenth century, slow or intermittent acceleration through the twentieth century, and more rapid acceleration over the past two decades. Meanwhile, satellite altimetry over the ocean basins since 1993 has revolutionized the monitoring of GMSL (Leuliette et al. 2004), showing an upward trend well correlated with the tide-gauge reconstruction that suggests an acceleration to 3.2 ± 0.4 mm year−1 (1993–2009) from the mean rate of 1.9 ± 0.4 mm year−1 since 1961 (Church and White 2011).

The sensitivity for detection of resistance mechanisms largely depends on the composition of the antibiotic drug panel used in the automated microdilution systems, which cannot be changed or modified by the user [2, 7]. The disk diffusion method readily permits detection of inducible phenotypes and most combinations of resistance mechanisms including Entospletinib price ESBL and AmpC co-production. The antibiotic panel composition is flexible and enables the clinical laboratory to readily adjust the composition of panels to its needs [8, 9]. Disadvantages of the disk diffusion method are its labour cost due to manual measurements and manual data documentation, and the investigator dependence

and variation of results [10]. During the past decade several R406 in vitro systems have been developed to automate disk diffusion readings. Systems like Sirscan (i2a, Montpellier, France), OSIRIS and ADAGIO (both BIO-RAD, Marne P5091 manufacturer La Coquotte, France),

Oxoid Aura (Oxoid Ltd., Basingstoke, UK), or BIOMIC (Giles Scientific Inc., Santa Barbara, California, USA) are able to automatically read inhibition zone diameters and incorporate expert systems for AST interpretation. These systems allow fully automated (Sirscan) or semi-automated reading (ADAGIO, Aura, BIOMIC), documentation and data interpretation using expert systems. The few studies available investigating the performance of automated zone reading systems indicate a high agreement with standard manual calliper (correlation coefficients ranging from 0.91 to 0.96) resulting in only few susceptibility categorisation errors [10–15]. However, some systems are no longer available (OSIRIS, Oxoid Aura), or have reported practical problems for routine use (BIOMIC) [16]. No studies are available investigating, if and to which extent fully automated zone reading is able to facilitate standardisation of inhibition zone diameter measurements.

High reproducibility and low variation of results become even more important in the light of the new CLSI and EUCAST AST guidelines that contain smaller intermediate susceptibility categories or, in case of EUCAST, Nutlin-3 manufacturer have even partially abandoned the use of the intermediate category. Directly adjacent susceptible and resistant categories lead to a higher frequency of major and very major errors (i.e. susceptible to resistant, resistant to susceptible) simply due to technical reasons, i.e. variation of individual measurements [17–19]. This study aimed at comparing the fully automated Sirscan with standard calliper measurements assessing: i) The agreement of inhibition zone diameter results (comparability), ii) The frequency of discrepancies in susceptibility categorisation (accuracy), and iii) Variation of repeat diameter measurements (reproducibility and precision). Methods Clinical isolates One hundred clinical bacterial isolates were selected as a representative sample of organisms routinely isolated in the clinical microbiological laboratory.

55383P (1:150, 100 μg/400 μl, AnaSpec, Fremont, CA) overnight at 4°C.

Sections were washed in PBS and incubated with Alexa Fluor 488-conjugated anti-mouse secondary antibodies (1:150, Invitrogen, La Jolla, CA) for 30 minutes at 4°C, followed by counterstained with DAPI (1:500). Sections were imaged and photographed with Leica TCS SP5 confocal scanning microscope (Leica Microsystems, Heidelberg GmbH, Mannheim, Idasanutlin mw Germany). The intensity of TNF-α immunofluorescence was quantified for each treatment group, with a minimum of 6 samples per group, using color threshold and area measurements with AnalySis software. Microbial analysis by denaturing gradient gel electrophoresis (DGGE) The DGGE analysis was carried out to identify the microbial community in the intestine and to study the potential changes between the different groups of zebrafish. Extraction of DNA and PCR amplification Bacterial DNA was extracted from pools of 20 zebrafish larvae using the QIAamp DNA Stool Mini Kit (QIAGEN, Hilden, Germany) selleck products according to the manufacturer’s ARS-1620 protocol, and stored at −20°C until use. PCR was performed on an Applied Biosysterm 2720 Thermal Cycler as a touchdown PCR. The hypervariable V3

region of the 16S ribosomal DNA gene was amplified using polymerase chain reaction (PCR) with forward primer (GC357f 5′CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGATTACCGCGGCTGCTGG3′) and reverse primer (518r 5′CCTACGGGAGGCAGCAG3′). The PCR reaction mixtures consisted of 2 μl of extracted bacterial DNA, 5 μl of 10×PCR buffer, 1 μl of dNTP mixture (2.5 mM each), 1 μl of each primer (10 pM), 0.5 μl of Taq-Polymerase (5 U/μl) and sterile water to final volume of 50 μl. The cycling program was as follows: predenaturation at 94°C for 5 min, followed by 20 cycles

of 94°C for 30 s, 65°C for 30 s decreased by 0.5°C for each cycle, and 68°C for 30 s, after which 10 additional cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s were Acesulfame Potassium carried out, and a final extension at 68°C for 7 min, soak at 4°C. Integrity of PCR products was determined by running agarose gel electrophoresis, and the quantity was determined using QubitTM fluorometer (Invitrogen, NY, USA). Denaturing gradient gel electrophoresis DGGE was performed on the PCR products from DNA samples using 16 cm × 16 cm ×1 mm gels with a DCode Universal Mutation Detection System (Bio-Rad, Hercules, CA). A 35-50% urea and formamide denaturing gradient and 8% polyacrylamide gel (37.5:1 acrylamide-bisacrylamide) were used. The gradient was prepared using the gradient delivery system (Bio-Rad), following the manufacturer’s protocol. A 100% denaturant solution contained 7 M urea and 40% formamide. Gels were run in 1×TAE (20 mM Tris, 10 mM acetate, 0.5 M EDTA, pH 7.4) at 60°C, first at 200 V for 10 minutes and then at 120 V for 7.5 hours.