55383P (1:150, 100 μg/400 μl, AnaSpec, Fremont, CA) overnight at 4°C.

Sections were washed in PBS and incubated with Alexa Fluor 488-conjugated anti-mouse secondary antibodies (1:150, Invitrogen, La Jolla, CA) for 30 minutes at 4°C, followed by counterstained with DAPI (1:500). Sections were imaged and photographed with Leica TCS SP5 confocal scanning microscope (Leica Microsystems, Heidelberg GmbH, Mannheim, Idasanutlin mw Germany). The intensity of TNF-α immunofluorescence was quantified for each treatment group, with a minimum of 6 samples per group, using color threshold and area measurements with AnalySis software. Microbial analysis by denaturing gradient gel electrophoresis (DGGE) The DGGE analysis was carried out to identify the microbial community in the intestine and to study the potential changes between the different groups of zebrafish. Extraction of DNA and PCR amplification Bacterial DNA was extracted from pools of 20 zebrafish larvae using the QIAamp DNA Stool Mini Kit (QIAGEN, Hilden, Germany) selleck products according to the manufacturer’s ARS-1620 protocol, and stored at −20°C until use. PCR was performed on an Applied Biosysterm 2720 Thermal Cycler as a touchdown PCR. The hypervariable V3

region of the 16S ribosomal DNA gene was amplified using polymerase chain reaction (PCR) with forward primer (GC357f 5′CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGATTACCGCGGCTGCTGG3′) and reverse primer (518r 5′CCTACGGGAGGCAGCAG3′). The PCR reaction mixtures consisted of 2 μl of extracted bacterial DNA, 5 μl of 10×PCR buffer, 1 μl of dNTP mixture (2.5 mM each), 1 μl of each primer (10 pM), 0.5 μl of Taq-Polymerase (5 U/μl) and sterile water to final volume of 50 μl. The cycling program was as follows: predenaturation at 94°C for 5 min, followed by 20 cycles

of 94°C for 30 s, 65°C for 30 s decreased by 0.5°C for each cycle, and 68°C for 30 s, after which 10 additional cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s were Acesulfame Potassium carried out, and a final extension at 68°C for 7 min, soak at 4°C. Integrity of PCR products was determined by running agarose gel electrophoresis, and the quantity was determined using QubitTM fluorometer (Invitrogen, NY, USA). Denaturing gradient gel electrophoresis DGGE was performed on the PCR products from DNA samples using 16 cm × 16 cm ×1 mm gels with a DCode Universal Mutation Detection System (Bio-Rad, Hercules, CA). A 35-50% urea and formamide denaturing gradient and 8% polyacrylamide gel (37.5:1 acrylamide-bisacrylamide) were used. The gradient was prepared using the gradient delivery system (Bio-Rad), following the manufacturer’s protocol. A 100% denaturant solution contained 7 M urea and 40% formamide. Gels were run in 1×TAE (20 mM Tris, 10 mM acetate, 0.5 M EDTA, pH 7.4) at 60°C, first at 200 V for 10 minutes and then at 120 V for 7.5 hours.