dendrorhous. Based on these observations, this study aimed to identify and characterize the X. dendrorhous C-22 sterol desaturase encoding gene, CYP61, and to evaluate the effect of its disruption on yeast ergosterol production and carotenogenesis. Results Cloning and sequence analysis of the CYP61 gene from X. dendrorhous Our NU7026 X. dendrorhous genomic database was analyzed with the BLAST tool of the CLC Genomics Workbench 5 software using as query several CYP61

gene sequences available in the GenBank database. In this way, we were able to identify a putative CYP61 gene (hereafter CYP61 gene) from X. dendrorhous, which allowed us to design specific primers to amplify and clone this gene. A fragment of approximately 4,200 bp [GenBank: JX183236] was PCR-amplified

using genomic DNA from strain UCD 67–385 as a template and the primer set CYP61up2.F + CYP61dw2.R (Table  1). This fragment was inserted at the EcoRV site of the pBluescript SK- plasmid, generating pBS-gCyp61. In parallel, the X. dendrorhous CYP61 cDNA was screened in a cDNA library by PCR using plasmid DNA from different clone mixtures as templates and the primer pair CYP61.F + CYP61.R (Table  1). The recombinant plasmid pBS-cCyp61, which contained the CYP61 gene cDNA with an ORF of 1,581 bp [GenBank: JX183235], was isolated. The sequence analysis of the genomic and cDNA versions of the CYP61 gene allowed us to PF-4708671 supplier determine that this gene consists of nine exons of 156, 152, 114, 75, 81, 441, 169, 320 and 73 bp, and eight introns of 317, 82, 90, 83, 84, 79, 116 and 111 bp (Figure  Z VAD FMK 2A). The CYP61 gene encodes a putative 526 amino acid CYP61 protein with a predicted molecular weight of 59.6 kDa and pI of 6.48. The CYP61

Verteporfin price deduced protein from X. dendrorhous shares 43% identity and 65% similarity at 95% sequence coverage with the Saccharomyces cerevisiae C22-sterol desaturase (CYP61, Swiss-Prot: P54781.1). This protein belongs to the cytochrome P450 protein family and is involved in the second last step of the ergosterol biosynthesis, the conversion of 5,7,24(28)-ergostatrienol into 5,7,22,24(28)-ergostatetraenol [25]. Table 1 Primers designed and used in this work Nº Primer Sequence 5’ to 3’ Target 1 H-out.F CTCGATGAGCTGATGCTTTG Hygromycin B resistance cassette 2 H-out.R TCCATCACAGTTTGCCAGTG Hygromycin B resistance cassette 3 Zeo.F TGAACAGGGTCACGTCGT Zeocin resistance cassette 4 Zeo.R CGCTGATGAACAGGGTCAC Zeocin resistance cassette 5 CYP61up2.F CTGGAGCCGAATTCATTGAT CYP61 gene 6 CYP61dw2.R AGGAGGCAGAGTGGTTGAGA CYP61 gene 7 CYP61b.F GTCGGAGGAAGAGCAGTTTG CYP61 gene 8 CYP61.F CTGAGCCCTGTCTTGTTGCC CYP61 gene 9 CYP61.R ATTGTACACCTTTGTTCCAGGC CYP61 gene RT-qPCR (The pairs of primers used had efficiency greater than 95%, as determined by standard curves with a correlation coefficient of R2 ≥ 0.996): 10 mactF-RT CCGCCCTCGTGATTGATAAC ACT gene 11 mactR-RT TCACCAACGTAGGAGTCCTT ACT gene 12 hmgR.F-RT GGCCGATCGCTATACATCCGTTT HMGR gene 13 hmgR.