Methods Cell culture and infection The human osteosarcoma cell line, SaOS2 and 293T cells were purchased from the American Type Culture Collection. Cells were grown in 5% CO2 saturated humidity, at 37°C and cultured in DMEM (Gibco, USA) supplemented with penicillin/streptomycin, 2 mmol/L glutamine and 10% FBS. Cells were buy RG7112 subcultured at 9 × 104 cells per well into 6-well tissue culture plates. After 24 h culture, cells were infected with recombinant

lentivirus vectors at a multiplicity of infection (MOI) of 40. Design of shRNA and plasmid preparation We designed and cloned a shRNA template into a lentivirus vector previously used [5]. A third generation self-inactivating lentivirus vector pGCL-GFP selleck screening library containing a CMV-driven GFP reporter and a U6 promoter upstream of the cloning sites. Three coding regions corresponding to targeting human COX-2 (GenBank Accession: NM 000963.2) were selected as siRNA target sequences (Table

1) under the guide of siRNA designing software offered by Genscript. We constructed three shRNA-COX-2 lentivirus vectors, namely LV-COX-2siRNA-1, LV-COX-2siRNA-2 and LV-COX-2siRNA-3, respectively. To detect the interference effects of different target, COX-2 mRNA and protein levels were determined using RT-PCR and western blotting. Recombinant lentivirus vectors and control lentivirus vector were produced by co-transfecting with the lentivirus expression plasmid and packaging plasmids

in 293T cells. Infectious lentiviruses Cilengitide clinical trial were harvested 48 h post-transfection, centrifuged and filtered through 0.45 um cellulose acetate filters. The infectious titer was determined by hole-by-dilution titer assay. The virus titers produced were approximately 109 transducing u/ml medium. Table 1 Interfering sequence specified for COX-2 gene   Sequence LV-COX-2siRNA-1 Oligo1: 5′TaaACACAGTGCACTACATACTTAtcaagagTAAGTATGTAGTG CACTGTGTTTTTTTTTC3′   Oligo2: 5′TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA GTATGTAGTGCACTGTGTTTA3′ LV- COX-2siRNA-2 Oligo1: 5′TaaTCACATTTGATTGACAGTCCAtcaagagTGGACTGTCAATC AAATGTGA TTTTTTTTC3′   Oligo2: 5′TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG ACTGTCAATCAAATGTGATTA3′ Dapagliflozin LV- COX-2siRNA-3 Oligo1: 5′TaaCCTTCTCTAACCTCTCCTATTtcaagagAATAGGAGAGGTT AGAGAAGGTTTTTTTTC3′   Oligo2: 5′TCGAGAAAAAAaaCCTTCTCTAACCTCTCCTATTctcttgaAAT AGGAGAGGTTAGAGAAGGTTA3′ The three interfering sequence targeted for human COX-2 gene were named LV-COX-2siRNA-1, LV-COX-2siRNA-2 and LV-COX-2siRNA-3, whose coding regions were corresponding to directly at human COX-2 (NM 000963.2) starting at 352, 456 and 517, respectively. Cell proliferation assay Cell proliferation was determined by 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay.